Review



plenticrisprv2 puro vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Addgene inc plenticrisprv2 puro vector
    Plenticrisprv2 Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 487 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenticrisprv2+vector/bio_rxiv__64898__2025__12__13__694153-311-8-10?v=Addgene+inc
    Average 98 stars, based on 487 article reviews
    plenticrisprv2 puro vector - by Bioz Stars, 2026-07
    98/100 stars

    Images



    Similar Products

    98
    Addgene inc plenticrisprv2 puro vector
    Plenticrisprv2 Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenticrisprv2+vector/bio_rxiv__64898__2025__12__13__694153-311-8-10?v=Addgene+inc
    Average 98 stars, based on 1 article reviews
    plenticrisprv2 puro vector - by Bioz Stars, 2026-07
    98/100 stars
      Buy from Supplier

    96
    Addgene inc plenticrisprv2 vector
    Plenticrisprv2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenticrisprv2+vector/bio_rxiv__2025__11__11__687896-164-14-16?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    plenticrisprv2 vector - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    93
    Addgene inc plxnb2
    a) IF showing loss of Plexin-B2 protein in <t>PLXNB2</t> ⁻/⁻ hESCs. n = 5 independent cultures per condition; unpaired two-tailed t-test. Bar graphs represent mean ± SEM. b) At D9 of differentiation, PLXNB2 ⁻/⁻ cells displayed reduced cortical F-actin and pMLC2 compared with WT. n = 5 independent cultures per condition, two-tailed nested t-test. c) Phase-contrast (top) and IF (bottom) images at D9. PLXNB2 ⁻/⁻ cells formed elongated projections (arrows) and showed increased DCX with reduced PAX6 compared with WT. n = 10 fields across two independent cultures; unpaired two-tailed t-test. d) IF for TUJ1 and SOX2 at D9. PLXNB2 ⁻/⁻ cells showed increased TUJ1 and reduced SOX2. Each data point represents the mean of multiple fields of view from two independent cultures; two-tailed nested t-test. Bar graphs represent mean ± SEM. e) Schematic and representative IF images from epistasis analysis. Latrunculin A (LatA, 0.5 µM) reduced cortical F-actin and promoted neurite protrusions in WT cells, mimicking Plexin-B2 knockout. Conversely, jasplakinolide (JPK, 0.5 µM) stabilized F-actin and suppressed projections in PLXNB2 ⁻/⁻ cells, restoring SOX2 expression. n = 3 images per condition; one-way ANOVA with Tukey’s test. Bar graphs represent mean ± SEM. f) Live-cell imaging of D6 cells labeled with NucSpot, SPY-tubulin, and SPY-actin over 30 hours. WT cells progressively reinforced cortical F-actin without protrusions, whereas PLXNB2 -/- cells showed diminished cortical actin and long tubulin-based projections.
    Plxnb2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenticrisprv2+vector/bio_rxiv__2025__09__19__677444-168-28-31?v=Addgene+inc
    Average 93 stars, based on 1 article reviews
    plxnb2 - by Bioz Stars, 2026-07
    93/100 stars
      Buy from Supplier

    96
    Addgene inc plenticrisprv2 blast vector
    a) IF showing loss of Plexin-B2 protein in <t>PLXNB2</t> ⁻/⁻ hESCs. n = 5 independent cultures per condition; unpaired two-tailed t-test. Bar graphs represent mean ± SEM. b) At D9 of differentiation, PLXNB2 ⁻/⁻ cells displayed reduced cortical F-actin and pMLC2 compared with WT. n = 5 independent cultures per condition, two-tailed nested t-test. c) Phase-contrast (top) and IF (bottom) images at D9. PLXNB2 ⁻/⁻ cells formed elongated projections (arrows) and showed increased DCX with reduced PAX6 compared with WT. n = 10 fields across two independent cultures; unpaired two-tailed t-test. d) IF for TUJ1 and SOX2 at D9. PLXNB2 ⁻/⁻ cells showed increased TUJ1 and reduced SOX2. Each data point represents the mean of multiple fields of view from two independent cultures; two-tailed nested t-test. Bar graphs represent mean ± SEM. e) Schematic and representative IF images from epistasis analysis. Latrunculin A (LatA, 0.5 µM) reduced cortical F-actin and promoted neurite protrusions in WT cells, mimicking Plexin-B2 knockout. Conversely, jasplakinolide (JPK, 0.5 µM) stabilized F-actin and suppressed projections in PLXNB2 ⁻/⁻ cells, restoring SOX2 expression. n = 3 images per condition; one-way ANOVA with Tukey’s test. Bar graphs represent mean ± SEM. f) Live-cell imaging of D6 cells labeled with NucSpot, SPY-tubulin, and SPY-actin over 30 hours. WT cells progressively reinforced cortical F-actin without protrusions, whereas PLXNB2 -/- cells showed diminished cortical actin and long tubulin-based projections.
    Plenticrisprv2 Blast Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenticrisprv2+vector/bio_rxiv__2025__09__05__674562-197-7-9?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    plenticrisprv2 blast vector - by Bioz Stars, 2026-07
    96/100 stars
      Buy from Supplier

    Image Search Results


    a) IF showing loss of Plexin-B2 protein in PLXNB2 ⁻/⁻ hESCs. n = 5 independent cultures per condition; unpaired two-tailed t-test. Bar graphs represent mean ± SEM. b) At D9 of differentiation, PLXNB2 ⁻/⁻ cells displayed reduced cortical F-actin and pMLC2 compared with WT. n = 5 independent cultures per condition, two-tailed nested t-test. c) Phase-contrast (top) and IF (bottom) images at D9. PLXNB2 ⁻/⁻ cells formed elongated projections (arrows) and showed increased DCX with reduced PAX6 compared with WT. n = 10 fields across two independent cultures; unpaired two-tailed t-test. d) IF for TUJ1 and SOX2 at D9. PLXNB2 ⁻/⁻ cells showed increased TUJ1 and reduced SOX2. Each data point represents the mean of multiple fields of view from two independent cultures; two-tailed nested t-test. Bar graphs represent mean ± SEM. e) Schematic and representative IF images from epistasis analysis. Latrunculin A (LatA, 0.5 µM) reduced cortical F-actin and promoted neurite protrusions in WT cells, mimicking Plexin-B2 knockout. Conversely, jasplakinolide (JPK, 0.5 µM) stabilized F-actin and suppressed projections in PLXNB2 ⁻/⁻ cells, restoring SOX2 expression. n = 3 images per condition; one-way ANOVA with Tukey’s test. Bar graphs represent mean ± SEM. f) Live-cell imaging of D6 cells labeled with NucSpot, SPY-tubulin, and SPY-actin over 30 hours. WT cells progressively reinforced cortical F-actin without protrusions, whereas PLXNB2 -/- cells showed diminished cortical actin and long tubulin-based projections.

    Journal: bioRxiv

    Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

    doi: 10.1101/2025.09.19.677444

    Figure Lengend Snippet: a) IF showing loss of Plexin-B2 protein in PLXNB2 ⁻/⁻ hESCs. n = 5 independent cultures per condition; unpaired two-tailed t-test. Bar graphs represent mean ± SEM. b) At D9 of differentiation, PLXNB2 ⁻/⁻ cells displayed reduced cortical F-actin and pMLC2 compared with WT. n = 5 independent cultures per condition, two-tailed nested t-test. c) Phase-contrast (top) and IF (bottom) images at D9. PLXNB2 ⁻/⁻ cells formed elongated projections (arrows) and showed increased DCX with reduced PAX6 compared with WT. n = 10 fields across two independent cultures; unpaired two-tailed t-test. d) IF for TUJ1 and SOX2 at D9. PLXNB2 ⁻/⁻ cells showed increased TUJ1 and reduced SOX2. Each data point represents the mean of multiple fields of view from two independent cultures; two-tailed nested t-test. Bar graphs represent mean ± SEM. e) Schematic and representative IF images from epistasis analysis. Latrunculin A (LatA, 0.5 µM) reduced cortical F-actin and promoted neurite protrusions in WT cells, mimicking Plexin-B2 knockout. Conversely, jasplakinolide (JPK, 0.5 µM) stabilized F-actin and suppressed projections in PLXNB2 ⁻/⁻ cells, restoring SOX2 expression. n = 3 images per condition; one-way ANOVA with Tukey’s test. Bar graphs represent mean ± SEM. f) Live-cell imaging of D6 cells labeled with NucSpot, SPY-tubulin, and SPY-actin over 30 hours. WT cells progressively reinforced cortical F-actin without protrusions, whereas PLXNB2 -/- cells showed diminished cortical actin and long tubulin-based projections.

    Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

    Techniques: Two Tailed Test, Knock-Out, Expressing, Live Cell Imaging, Labeling

    a) UMAP embedding of snRNA-seq data from D9 cells (n = 3 replicates per genotype). WT cells segregated into clusters enriched for radial glia (RG), neural progenitors (NPCs), and ESC-like states, whereas KO cells aligned with differentiated neuronal clusters. b) Feature plots showing expression of NPC and neuronal markers. c) Expression of representative marker genes across D9 subclusters. d) Volcano plot of differentially expressed genes (DEGs; PLXNB2 -/- vs. WT), with selected genes highlighted. e) Bubble plot of enriched pathways upregulated in D9 PLXNB2 ⁻/⁻ cells. f) ENRICHR GO enrichment analysis of DEGs for categories of biological process (BP), cellular component (CC), and molecular function (MF), color-coded by theme. g) Violin plots showing downregulation of actin cytoskeleton–associated genes in PLXNB2 -/- cells. h) Heatmap of DEGs grouped by functional categories, across three replicates per genotype. i) Ingenuity Pathway Analysis (IPA) network summary. Growth factor signaling pathways were broadly suppressed, while PTEN was activated in PLXNB2 ⁻/⁻ cells. j) Predicted upstream regulators (IPA) of DEGs in PLXNB2 ⁻/⁻ vs. WT cells. k) Developmental stage scoring against human cortex gene signatures (Velmeshev et al., 2023). D9 WT cells aligned with 2 nd -3 rd trimester profiles, whereas PLXNB2 ⁻/⁻ cells shifted toward postnatal signatures.

    Journal: bioRxiv

    Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

    doi: 10.1101/2025.09.19.677444

    Figure Lengend Snippet: a) UMAP embedding of snRNA-seq data from D9 cells (n = 3 replicates per genotype). WT cells segregated into clusters enriched for radial glia (RG), neural progenitors (NPCs), and ESC-like states, whereas KO cells aligned with differentiated neuronal clusters. b) Feature plots showing expression of NPC and neuronal markers. c) Expression of representative marker genes across D9 subclusters. d) Volcano plot of differentially expressed genes (DEGs; PLXNB2 -/- vs. WT), with selected genes highlighted. e) Bubble plot of enriched pathways upregulated in D9 PLXNB2 ⁻/⁻ cells. f) ENRICHR GO enrichment analysis of DEGs for categories of biological process (BP), cellular component (CC), and molecular function (MF), color-coded by theme. g) Violin plots showing downregulation of actin cytoskeleton–associated genes in PLXNB2 -/- cells. h) Heatmap of DEGs grouped by functional categories, across three replicates per genotype. i) Ingenuity Pathway Analysis (IPA) network summary. Growth factor signaling pathways were broadly suppressed, while PTEN was activated in PLXNB2 ⁻/⁻ cells. j) Predicted upstream regulators (IPA) of DEGs in PLXNB2 ⁻/⁻ vs. WT cells. k) Developmental stage scoring against human cortex gene signatures (Velmeshev et al., 2023). D9 WT cells aligned with 2 nd -3 rd trimester profiles, whereas PLXNB2 ⁻/⁻ cells shifted toward postnatal signatures.

    Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

    Techniques: Expressing, Marker, Functional Assay, Protein-Protein interactions

    a) Workflow for generating anti-Plexin-B2 (PB2) nanobodies (Nbs). Camelids were immunized with recombinant extracellular domain of human PB2 protein, followed by phage display to isolate high-affinity VHHs, which were fused to human Fc (hFc). b) Experimental design. VHH-Fc Nbs (10 μg/ml) were added one day before iN protocol. c) Representative images showing reduced cortical F-actin, increased DCX and TUJ1, and decreased SOX2 in D10 cells treated with two independent anti-PB2 Nbs compared with control or no Nb. d) Quantification of marker expression. Each dot represents the mean of a field of view. n = 5 cultures for each condition; one-way ANOVA with Dunnett’s multiple-comparison test. Bar graphs represent mean ± SEM.

    Journal: bioRxiv

    Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

    doi: 10.1101/2025.09.19.677444

    Figure Lengend Snippet: a) Workflow for generating anti-Plexin-B2 (PB2) nanobodies (Nbs). Camelids were immunized with recombinant extracellular domain of human PB2 protein, followed by phage display to isolate high-affinity VHHs, which were fused to human Fc (hFc). b) Experimental design. VHH-Fc Nbs (10 μg/ml) were added one day before iN protocol. c) Representative images showing reduced cortical F-actin, increased DCX and TUJ1, and decreased SOX2 in D10 cells treated with two independent anti-PB2 Nbs compared with control or no Nb. d) Quantification of marker expression. Each dot represents the mean of a field of view. n = 5 cultures for each condition; one-way ANOVA with Dunnett’s multiple-comparison test. Bar graphs represent mean ± SEM.

    Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

    Techniques: Recombinant, Control, Marker, Expressing, Comparison

    a) Standard forebrain and midbrain neuronal differentiation protocols. At D36, WT cells generated dense networks of TUJ1⁺ axon-bearing neurons, whereas PLXNB2 ⁻/⁻ cells displayed aberrant morphologies. b) Accelerated protocol. After passage at D9, cells were switched directly to maturation medium, bypassing the differentiation media step. By D18a, PLXNB2 ⁻/⁻ cells developed dense networks of TUJ1⁺ axon-bearing neurons, while WT cells retained progenitor-like morphology. c) IF comparison of neuronal markers and morphology in D36 WT (standard protocol) and D18a PLXNB2 ⁻/⁻ (accelerated protocol) cells. d) UMAP embedding of D18a PLXNB2⁻/⁻ and D36 WT iNs, showing segregation by genotype and forebrain vs. midbrain protocols. e) Feature plots showing shared neuronal markers across subclusters and genotypes. f) Transcriptional profiling revealed comparable expression of core neuronal/axonal markers between D36 WT and D18a PLXNB2 ⁻/⁻ cells, but lower expression of functional genes in the latter. g) Experimental timeline and IF images show co-culture of iNs with GFAP⁺ astrocyte lawns to promote maturation. h) Multi-electrode array (MEA) recordings. PLXNB2 ⁻/⁻ cells after maturation exhibited higher firing rates and synchrony index than WT cells (n = 6 cultures per condition; one-way ANOVA with Dunnett’s correction). Bar graphs represent mean ± SEM. i) Heatmap of epigenetic regulators shows convergent transcriptional shifts of D36 WT and D18a PLXNB2 ⁻/⁻ iNs relative to D9 WT cells. D9 PLXNB2 ⁻/⁻ cells already exhibited a similar shift, indicating accelerated epigenetic reprogramming. j) D9 PLXNB2 ⁻/⁻ cells showed elevated nuclear TET3 compared with D9 WT, reaching levels comparable to D36 WT. n = 5 fields from 2 independent experiments for each condition, nested one-way ANOVA with Tukey’s multiple-comparison test. k) D9 PLXNB2 ⁻/⁻ cells exhibited precocious expression of lamin A/C, similar to D36 WT and D18a PLXNB2 ⁻/⁻ iNs. l) Working model: Plexin-B2-mediated cortical tension act as a mechanical barrier alongside an epigenetic barrier to prevent precocious differentiation.

    Journal: bioRxiv

    Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

    doi: 10.1101/2025.09.19.677444

    Figure Lengend Snippet: a) Standard forebrain and midbrain neuronal differentiation protocols. At D36, WT cells generated dense networks of TUJ1⁺ axon-bearing neurons, whereas PLXNB2 ⁻/⁻ cells displayed aberrant morphologies. b) Accelerated protocol. After passage at D9, cells were switched directly to maturation medium, bypassing the differentiation media step. By D18a, PLXNB2 ⁻/⁻ cells developed dense networks of TUJ1⁺ axon-bearing neurons, while WT cells retained progenitor-like morphology. c) IF comparison of neuronal markers and morphology in D36 WT (standard protocol) and D18a PLXNB2 ⁻/⁻ (accelerated protocol) cells. d) UMAP embedding of D18a PLXNB2⁻/⁻ and D36 WT iNs, showing segregation by genotype and forebrain vs. midbrain protocols. e) Feature plots showing shared neuronal markers across subclusters and genotypes. f) Transcriptional profiling revealed comparable expression of core neuronal/axonal markers between D36 WT and D18a PLXNB2 ⁻/⁻ cells, but lower expression of functional genes in the latter. g) Experimental timeline and IF images show co-culture of iNs with GFAP⁺ astrocyte lawns to promote maturation. h) Multi-electrode array (MEA) recordings. PLXNB2 ⁻/⁻ cells after maturation exhibited higher firing rates and synchrony index than WT cells (n = 6 cultures per condition; one-way ANOVA with Dunnett’s correction). Bar graphs represent mean ± SEM. i) Heatmap of epigenetic regulators shows convergent transcriptional shifts of D36 WT and D18a PLXNB2 ⁻/⁻ iNs relative to D9 WT cells. D9 PLXNB2 ⁻/⁻ cells already exhibited a similar shift, indicating accelerated epigenetic reprogramming. j) D9 PLXNB2 ⁻/⁻ cells showed elevated nuclear TET3 compared with D9 WT, reaching levels comparable to D36 WT. n = 5 fields from 2 independent experiments for each condition, nested one-way ANOVA with Tukey’s multiple-comparison test. k) D9 PLXNB2 ⁻/⁻ cells exhibited precocious expression of lamin A/C, similar to D36 WT and D18a PLXNB2 ⁻/⁻ iNs. l) Working model: Plexin-B2-mediated cortical tension act as a mechanical barrier alongside an epigenetic barrier to prevent precocious differentiation.

    Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

    Techniques: Generated, Comparison, Expressing, Functional Assay, Co-Culture Assay

    a) IF of day 42 cerebral organoids shows broad Plexin-B2 expression in the ventricular zone (VZ; SOX2⁺) and cortical plate (CP), including FAM107A⁺ outer radial glia. b) IF of human fetal brain at 23 gestational weeks reveals broad Plexin-B2 expression in the SOX2⁺ germinal matrix and developing cortex, including FAM107A⁺ cells. c) Representative images and quantification of organoid diameters show reduced size in PLXNB2 ⁻/⁻ organoids (WT, n = 15; KO, n = 16). Bar graphs represent mean ± SEM; unpaired two-tailed Student’s t-test. d) Left, IF demonstrates loss of Plexin-B2 in d42 KO organoids. Right, Western blot confirms Plexin-B2 ablation, with β-actin as loading control. Quantification from n = 3 independent experiments. unpaired two-tailed Student’s t -test. e) Left, IF reveals disrupted architecture of KO organoids with shrinkage of SOX2 + VZ. Right, Western blot and heatmap show reduced SOX2 and increased TUJ1. n = 3 independent cultures per condition; unpaired two-tailed Student’s t-test. f) KO organoids exhibit expanded but disorganized DCX⁺ neuroblasts and reduced PAX6⁺ progenitors. g) Disrupted neuroepithelial organization in KO organoids, with diffuse β-catenin, N-cadherin, and reduced apical F-actin enrichment. h) WT organoids contain a dense apical ring of proliferating Ki67⁺/pH3⁺ cells, which was reduced and mislocalized in KO organoids. i) EdU pulse-chase assay design (30 min pulse, 24 h chase). KO organoids showed increased cell-cycle exit (i.e. fraction of Ki67⁻ cells among EdU⁺ cells). n = 6 fields from 3 independent organoids for each condition; unpaired two-tailed t-test. j) Model: Plexin-B2 maintains progenitor pool homeostasis by regulating the timing of neuronal differentiation. Loss of Plexin-B2 leads to premature cell-cycle exit, precocious neuronal differentiation, and progenitor depletion.

    Journal: bioRxiv

    Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

    doi: 10.1101/2025.09.19.677444

    Figure Lengend Snippet: a) IF of day 42 cerebral organoids shows broad Plexin-B2 expression in the ventricular zone (VZ; SOX2⁺) and cortical plate (CP), including FAM107A⁺ outer radial glia. b) IF of human fetal brain at 23 gestational weeks reveals broad Plexin-B2 expression in the SOX2⁺ germinal matrix and developing cortex, including FAM107A⁺ cells. c) Representative images and quantification of organoid diameters show reduced size in PLXNB2 ⁻/⁻ organoids (WT, n = 15; KO, n = 16). Bar graphs represent mean ± SEM; unpaired two-tailed Student’s t-test. d) Left, IF demonstrates loss of Plexin-B2 in d42 KO organoids. Right, Western blot confirms Plexin-B2 ablation, with β-actin as loading control. Quantification from n = 3 independent experiments. unpaired two-tailed Student’s t -test. e) Left, IF reveals disrupted architecture of KO organoids with shrinkage of SOX2 + VZ. Right, Western blot and heatmap show reduced SOX2 and increased TUJ1. n = 3 independent cultures per condition; unpaired two-tailed Student’s t-test. f) KO organoids exhibit expanded but disorganized DCX⁺ neuroblasts and reduced PAX6⁺ progenitors. g) Disrupted neuroepithelial organization in KO organoids, with diffuse β-catenin, N-cadherin, and reduced apical F-actin enrichment. h) WT organoids contain a dense apical ring of proliferating Ki67⁺/pH3⁺ cells, which was reduced and mislocalized in KO organoids. i) EdU pulse-chase assay design (30 min pulse, 24 h chase). KO organoids showed increased cell-cycle exit (i.e. fraction of Ki67⁻ cells among EdU⁺ cells). n = 6 fields from 3 independent organoids for each condition; unpaired two-tailed t-test. j) Model: Plexin-B2 maintains progenitor pool homeostasis by regulating the timing of neuronal differentiation. Loss of Plexin-B2 leads to premature cell-cycle exit, precocious neuronal differentiation, and progenitor depletion.

    Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

    Techniques: Expressing, Two Tailed Test, Western Blot, Control, Pulse Chase

    a) UMAP embedding of snRNA-seq profiles from day 42 cerebral organoids (n = 3 replicates per genotype). EN, excitatory neurons; Mes, mesenchymal-like; Epen, ependymal-like; SCP, Schwann cell precursor/neural crest-like. b) Stacked bar plots show loss of RG (sc0) and expansion of subplate-like (sc3) and maturing EN (sc6) populations in PLXNB2 ⁻/⁻ organoids, reflecting accelerated neurogenesis and lineage imbalance. c) Dot plot showing expression of marker genes across annotated subclusters. d) Feature plots highlighting distinctive marker gene expression in WT vs. PLXNB2 ⁻/⁻ subclusters. e) Volcano plot of DEGs (adj. P < 0.05, log 2 FC > 1) with selected genes labeled. f) GO enrichment analysis of DEGs, grouped by biological process (BP), cellular component (CC), and molecular function (MF), color-coded by theme. g) Heatmap showing functional gene groups: WT organoids upregulated mature neuronal and synaptic genes, whereas PLXNB2 ⁻/⁻ organoids upregulated stromal/EMT-associated genes, indicating lineage instability and aberrant mesenchymal-like states. h) IPA network analysis revealed broad suppression of progenitor/neuronal regulatory pathways in KO organoids, with limited activation of developmental branching and stress-response regulators. i) Predicted upstream regulators of DEGs, including suppression of proliferation- and neurogenesis-associated TFs and activation of senescence and stress regulators. j) Transcriptome scoring against human cortical developmental signatures (Velmeshev et al., 2023) with WT organoid cells primarily aligning with 2 nd trimester signatures, whereas PLXNB2 ⁻/⁻ organoids also align with postnatal/adult signatures, indicating accelerated developmental age. k) Comparative IPA of PLXNB2 ⁻/⁻ vs. WT in D36 iNs and d42 organoids revealed convergent alterations in neuronal differentiation and brain morphology pathways, supporting both models for Plexin-B2-linked neurodevelopmental defects. l) Model: Plexin-B2 enforces a cortical mechanical barrier integrated with an epigenetic barrier to safeguard the timing of neuronal differentiation. Loss of Plexin-B2 lowers this barrier, leading to premature epigenetic reprogramming, accelerated neurogenesis, and lineage instability.

    Journal: bioRxiv

    Article Title: Cortical tension as a mechanical barrier to safeguard against premature differentiation during neurogenesis

    doi: 10.1101/2025.09.19.677444

    Figure Lengend Snippet: a) UMAP embedding of snRNA-seq profiles from day 42 cerebral organoids (n = 3 replicates per genotype). EN, excitatory neurons; Mes, mesenchymal-like; Epen, ependymal-like; SCP, Schwann cell precursor/neural crest-like. b) Stacked bar plots show loss of RG (sc0) and expansion of subplate-like (sc3) and maturing EN (sc6) populations in PLXNB2 ⁻/⁻ organoids, reflecting accelerated neurogenesis and lineage imbalance. c) Dot plot showing expression of marker genes across annotated subclusters. d) Feature plots highlighting distinctive marker gene expression in WT vs. PLXNB2 ⁻/⁻ subclusters. e) Volcano plot of DEGs (adj. P < 0.05, log 2 FC > 1) with selected genes labeled. f) GO enrichment analysis of DEGs, grouped by biological process (BP), cellular component (CC), and molecular function (MF), color-coded by theme. g) Heatmap showing functional gene groups: WT organoids upregulated mature neuronal and synaptic genes, whereas PLXNB2 ⁻/⁻ organoids upregulated stromal/EMT-associated genes, indicating lineage instability and aberrant mesenchymal-like states. h) IPA network analysis revealed broad suppression of progenitor/neuronal regulatory pathways in KO organoids, with limited activation of developmental branching and stress-response regulators. i) Predicted upstream regulators of DEGs, including suppression of proliferation- and neurogenesis-associated TFs and activation of senescence and stress regulators. j) Transcriptome scoring against human cortical developmental signatures (Velmeshev et al., 2023) with WT organoid cells primarily aligning with 2 nd trimester signatures, whereas PLXNB2 ⁻/⁻ organoids also align with postnatal/adult signatures, indicating accelerated developmental age. k) Comparative IPA of PLXNB2 ⁻/⁻ vs. WT in D36 iNs and d42 organoids revealed convergent alterations in neuronal differentiation and brain morphology pathways, supporting both models for Plexin-B2-linked neurodevelopmental defects. l) Model: Plexin-B2 enforces a cortical mechanical barrier integrated with an epigenetic barrier to safeguard the timing of neuronal differentiation. Loss of Plexin-B2 lowers this barrier, leading to premature epigenetic reprogramming, accelerated neurogenesis, and lineage instability.

    Article Snippet: In brief, low passage hESCs were stably transduced with lentiviral particles produced in HEK293T cells using plenti-CRISPRv2 vectors encoding Cas9 and an sgRNA targeting either exon 2 of PLXNB2 (sequence: GTTCTCGGCGGCGACCGTCA; Addgene #86152) or the EGFP coding sequence (sequence: GGGCGAGGAGCTGTTCACCG; Addgene #86153).

    Techniques: Expressing, Marker, Gene Expression, Labeling, Functional Assay, Activation Assay